Transcript: Mouse NM_001080931.1

Mus musculus mediator complex subunit 13 (Med13), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Med13 (327987)
Length:
11787
CDS:
1..6516

Additional Resources:

NCBI RefSeq record:
NM_001080931.1
NBCI Gene record:
Med13 (327987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001080931.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226204 ACAAGATCAATGCACTAATTT pLKO_005 3573 CDS 100% 15.000 21.000 N Med13 n/a
2 TRCN0000234904 GTTTAGGGCTATGACTAATAT pLKO_005 7412 3UTR 100% 15.000 21.000 N MED13 n/a
3 TRCN0000226206 TCCCGTAGGCAGTGGTATAAA pLKO_005 10935 3UTR 100% 15.000 21.000 N Med13 n/a
4 TRCN0000252364 GATGCTCCACGCCCTACAAAT pLKO_005 2260 CDS 100% 13.200 18.480 N Med13 n/a
5 TRCN0000252365 TAACGAATACAGGGAGTTAAA pLKO_005 11582 3UTR 100% 13.200 18.480 N Med13 n/a
6 TRCN0000019916 CCGAACTAATGATGTAGCAAA pLKO.1 1533 CDS 100% 4.950 6.930 N MED13 n/a
7 TRCN0000218709 GAATTAACACCTGGATCTAAA pLKO_005 2374 CDS 100% 13.200 10.560 N Med13 n/a
8 TRCN0000226205 TCGCATGATGAAGTAACTAAT pLKO_005 6142 CDS 100% 13.200 10.560 N Med13 n/a
9 TRCN0000252366 ATCTTGATCCTGATATCATTA pLKO_005 6008 CDS 100% 13.200 9.240 N Med13 n/a
10 TRCN0000226203 CCGCACAGAAGTGGGTCAAAT pLKO_005 1022 CDS 100% 13.200 9.240 N Med13 n/a
11 TRCN0000252367 GATACATCCTGTACTCATATA pLKO_005 5851 CDS 100% 13.200 9.240 N Med13 n/a
12 TRCN0000252363 ACCGAAACTTTGTACGAATTG pLKO_005 398 CDS 100% 10.800 7.560 N Med13 n/a
13 TRCN0000019918 CCTGGAAGATTGTCACTGTAA pLKO.1 33 CDS 100% 4.950 3.465 N MED13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080931.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.