Transcript: Human NM_001081.4

Homo sapiens cubilin (CUBN), mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
CUBN (8029)
Length:
11927
CDS:
47..10918

Additional Resources:

NCBI RefSeq record:
NM_001081.4
NBCI Gene record:
CUBN (8029)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001081.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055649 GCAGTGACAATGCTCTCTATT pLKO.1 1722 CDS 100% 13.200 9.240 N CUBN n/a
2 TRCN0000055651 CCCAGGGAGAACAAATACAAA pLKO.1 2268 CDS 100% 5.625 3.938 N CUBN n/a
3 TRCN0000055648 CCTGCCAATTATCCAAACAAT pLKO.1 4958 CDS 100% 5.625 3.938 N CUBN n/a
4 TRCN0000055650 GCAGCGCATTTGAACTGGAAT pLKO.1 3645 CDS 100% 4.950 3.465 N CUBN n/a
5 TRCN0000055652 CCTTCCACTTAGAAGCTCGTT pLKO.1 8937 CDS 100% 2.640 1.848 N CUBN n/a
6 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 11258 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.