Transcript: Mouse NM_001081060.1

Mus musculus solute carrier family 9 (sodium/hydrogen exchanger), member 3 (Slc9a3), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Slc9a3 (105243)
Length:
2490
CDS:
1..2490

Additional Resources:

NCBI RefSeq record:
NM_001081060.1
NBCI Gene record:
Slc9a3 (105243)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251711 TTTCAGGGCCTGACCATTAAG pLKO_005 1336 CDS 100% 13.200 18.480 N Slc9a3 n/a
2 TRCN0000251712 GTACGGACAATATGGTCAATG pLKO_005 1673 CDS 100% 10.800 15.120 N Slc9a3 n/a
3 TRCN0000251710 CAGAGATAAGTGGTCCAATTT pLKO_005 1494 CDS 100% 13.200 10.560 N Slc9a3 n/a
4 TRCN0000251709 ATGCTGTCATTGGCACTATAT pLKO_005 422 CDS 100% 13.200 9.240 N Slc9a3 n/a
5 TRCN0000069930 CATACATCATTGCGCTCTGGA pLKO.1 149 CDS 100% 2.640 1.848 N LOC432778 n/a
6 TRCN0000267394 AGTGGAGCAGAGACCATTATC pLKO_005 1015 CDS 100% 13.200 7.920 N Slc9a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.