Transcript: Mouse NM_001081071.2

Mus musculus lysocardiolipin acyltransferase 1 (Lclat1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lclat1 (225010)
Length:
4476
CDS:
198..1328

Additional Resources:

NCBI RefSeq record:
NM_001081071.2
NBCI Gene record:
Lclat1 (225010)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081071.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252924 TATAGTAGTTGTGGGTTATTT pLKO_005 3554 3UTR 100% 15.000 21.000 N Lclat1 n/a
2 TRCN0000267446 CCATGCAAGTTGCGGCCTTTA pLKO_005 568 CDS 100% 10.800 15.120 N Lclat1 n/a
3 TRCN0000252927 CAGCCCTGTTCGGTGGTATTT pLKO_005 1184 CDS 100% 13.200 10.560 N Lclat1 n/a
4 TRCN0000252926 TGTCGTGGTATCGCTGGATTA pLKO_005 304 CDS 100% 10.800 8.640 N Lclat1 n/a
5 TRCN0000252925 GCAATGTGCCTGCTCATATAT pLKO_005 1158 CDS 100% 15.000 9.000 N Lclat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081071.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15294 pDONR223 93.4% 77.1% 80.9% None (many diffs) n/a
2 ccsbBroad304_15294 pLX_304 0% 77.1% 80.9% V5 (many diffs) n/a
3 TRCN0000476513 TACTAGGCTGACTGCGAATCGGAA pLX_317 28% 77.1% 80.9% V5 (many diffs) n/a
Download CSV