Transcript: Mouse NM_001081077.1

Mus musculus CWF19-like 1, cell cycle control (S. pombe) (Cwf19l1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Cwf19l1 (72502)
Length:
3581
CDS:
89..1702

Additional Resources:

NCBI RefSeq record:
NM_001081077.1
NBCI Gene record:
Cwf19l1 (72502)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267399 TGCTCGGCTTCCCAGTTTAAA pLKO_005 509 CDS 100% 15.000 21.000 N Cwf19l1 n/a
2 TRCN0000251524 TTCAATAGAGTTCGGACAATT pLKO_005 152 CDS 100% 13.200 10.560 N Cwf19l1 n/a
3 TRCN0000251527 ACAGAGTTTAGAGTCTAATTT pLKO_005 2448 3UTR 100% 15.000 10.500 N Cwf19l1 n/a
4 TRCN0000251525 TGCTGAGTGGGAGGAGTATAA pLKO_005 238 CDS 100% 13.200 9.240 N Cwf19l1 n/a
5 TRCN0000251526 CTGTCAGTTCTTCTTCGATTT pLKO_005 949 CDS 100% 10.800 7.560 N Cwf19l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08504 pDONR223 100% 87.6% 89% None (many diffs) n/a
2 ccsbBroad304_08504 pLX_304 0% 87.6% 89% V5 (many diffs) n/a
3 TRCN0000465749 TCGGTGCGACCACCAACACATAGC pLX_317 23.3% 87.6% 89% V5 (many diffs) n/a
Download CSV