Transcript: Mouse NM_001081130.1

Mus musculus oxoglutarate dehydrogenase-like (Ogdhl), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ogdhl (239017)
Length:
3449
CDS:
169..3258

Additional Resources:

NCBI RefSeq record:
NM_001081130.1
NBCI Gene record:
Ogdhl (239017)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251614 ACATAAGAACATGGGCTATTA pLKO_005 3060 CDS 100% 13.200 18.480 N Ogdhl n/a
2 TRCN0000251615 CCTGCTCTCAAGACCATTATC pLKO_005 1048 CDS 100% 13.200 9.240 N Ogdhl n/a
3 TRCN0000251616 GATCTTCTGAAGGAGGTTATA pLKO_005 3262 3UTR 100% 13.200 9.240 N Ogdhl n/a
4 TRCN0000251613 GTGTACTATGACCTGGTAAAG pLKO_005 2905 CDS 100% 10.800 7.560 N Ogdhl n/a
5 TRCN0000251612 CTTGATCACAACCATTGATAA pLKO_005 621 CDS 100% 13.200 7.920 N Ogdhl n/a
6 TRCN0000426222 TGATCACAACCATTGATAAAC pLKO_005 623 CDS 100% 13.200 18.480 N OGDHL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08578 pDONR223 100% 85.9% 91.2% None (many diffs) n/a
2 ccsbBroad304_08578 pLX_304 0% 85.9% 91.2% V5 (many diffs) n/a
3 TRCN0000473460 TGCAGGAATTATCTCCTTCGTCTG pLX_317 17.5% 85.9% 91.2% V5 (many diffs) n/a
Download CSV