Transcript: Mouse NM_001081132.1

Mus musculus UPF2 regulator of nonsense transcripts homolog (yeast) (Upf2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Upf2 (326622)
Length:
5174
CDS:
104..3913

Additional Resources:

NCBI RefSeq record:
NM_001081132.1
NBCI Gene record:
Upf2 (326622)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081132.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242162 AGGCGTATTCTGCACTCTAAA pLKO_005 1244 CDS 100% 13.200 18.480 N Upf2 n/a
2 TRCN0000242163 CTAGAGAGTTGCGAATCTAAA pLKO_005 4018 3UTR 100% 13.200 18.480 N Upf2 n/a
3 TRCN0000242161 CCGCCTAGATTCGAGCTTAAA pLKO_005 586 CDS 100% 13.200 10.560 N Upf2 n/a
4 TRCN0000242160 ATACCTGTGGCCAGTACTTTG pLKO_005 2877 CDS 100% 10.800 8.640 N Upf2 n/a
5 TRCN0000242164 AGCACCTAATGCAGATCTAAT pLKO_005 3865 CDS 100% 13.200 9.240 N Upf2 n/a
6 TRCN0000152872 GCGTTATGTTTGGTGGAAGAA pLKO.1 2947 CDS 100% 4.950 3.465 N UPF2 n/a
7 TRCN0000338889 GCGTTATGTTTGGTGGAAGAA pLKO_005 2947 CDS 100% 4.950 3.465 N UPF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081132.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.