Transcript: Mouse NM_001081150.1

Mus musculus LON peptidase N-terminal domain and ring finger 1 (Lonrf1), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Lonrf1 (244421)
Length:
3930
CDS:
38..2551

Additional Resources:

NCBI RefSeq record:
NM_001081150.1
NBCI Gene record:
Lonrf1 (244421)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251373 ACCAAGAATGTCCCAATATTC pLKO_005 1922 CDS 100% 13.200 18.480 N Lonrf1 n/a
2 TRCN0000251371 CTACGGTCTAGAGTATCATTT pLKO_005 3271 3UTR 100% 13.200 18.480 N Lonrf1 n/a
3 TRCN0000251370 TGCCAGGGAGGACGGTTTAAA pLKO_005 1435 CDS 100% 15.000 10.500 N Lonrf1 n/a
4 TRCN0000251369 TTATGGTTGTATGCTACAAAT pLKO_005 2086 CDS 100% 13.200 9.240 N Lonrf1 n/a
5 TRCN0000251372 AGGAACGGTTGACGAAGATAC pLKO_005 2490 CDS 100% 10.800 7.560 N Lonrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12968 pDONR223 100% 42.4% 44.8% None (many diffs) n/a
2 ccsbBroad304_12968 pLX_304 0% 42.4% 44.8% V5 (many diffs) n/a
3 TRCN0000466802 ATGCCCGGGGAGTCGTACGTAAGG pLX_317 22.9% 42.4% 44.8% V5 (many diffs) n/a
Download CSV