Transcript: Mouse NM_001081189.1

Mus musculus uracil phosphoribosyltransferase (Uprt), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Uprt (331487)
Length:
1112
CDS:
180..1112

Additional Resources:

NCBI RefSeq record:
NM_001081189.1
NBCI Gene record:
Uprt (331487)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081189.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252524 CTGTCACAATCGGCAAGTAAA pLKO_005 215 CDS 100% 13.200 18.480 N Uprt n/a
2 TRCN0000252525 ATCCGGGAGCTTCAGACTATC pLKO_005 537 CDS 100% 10.800 15.120 N Uprt n/a
3 TRCN0000252526 GTGAACTCTCCCGACAGATTG pLKO_005 481 CDS 100% 10.800 15.120 N Uprt n/a
4 TRCN0000252523 CAAAGGGCCAAAGTATATTAT pLKO_005 828 CDS 100% 15.000 10.500 N Uprt n/a
5 TRCN0000252527 CTGAATCAGCTGCCATATAAA pLKO_005 636 CDS 100% 15.000 10.500 N Uprt n/a
6 TRCN0000413187 ATGGTGCCAAATCAATCATTC pLKO_005 1003 CDS 100% 10.800 7.560 N UPRT n/a
7 TRCN0000431473 GAGGCAATGGAACAAGGTTTA pLKO_005 747 CDS 100% 10.800 7.560 N UPRT n/a
8 TRCN0000421399 TGCCTATGAATGATCAGATAC pLKO_005 520 CDS 100% 10.800 7.560 N UPRT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081189.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09583 pDONR223 100% 88.5% 86.1% None (many diffs) n/a
2 ccsbBroad304_09583 pLX_304 0% 88.5% 86.1% V5 (many diffs) n/a
3 TRCN0000465960 GTAATTTTCATGTTATTGAATACA pLX_317 33.3% 88.5% 86.1% V5 (many diffs) n/a
Download CSV