Transcript: Mouse NM_001081224.2

Mus musculus proline rich 16 (Prr16), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Prr16 (71373)
Length:
2224
CDS:
34..948

Additional Resources:

NCBI RefSeq record:
NM_001081224.2
NBCI Gene record:
Prr16 (71373)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254508 CGGGAACGAGTTCGGTTTAAT pLKO_005 637 CDS 100% 15.000 21.000 N Prr16 n/a
2 TRCN0000254509 CTAATGTTCCTGAGGATTAAA pLKO_005 1584 3UTR 100% 15.000 10.500 N Prr16 n/a
3 TRCN0000254512 GTGAGAGCCGGTATAACATAA pLKO_005 692 CDS 100% 13.200 9.240 N Prr16 n/a
4 TRCN0000254511 CCACTACCACAGTGTGATATC pLKO_005 932 CDS 100% 10.800 7.560 N Prr16 n/a
5 TRCN0000271254 TGCTGCATACCCAACAGTAAC pLKO_005 547 CDS 100% 10.800 7.560 N PRR16 n/a
6 TRCN0000254510 AGGAGCAGATCAAGATCATAG pLKO_005 113 CDS 100% 10.800 6.480 N Prr16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11978 pDONR223 100% 67.6% 70% None (many diffs) n/a
2 ccsbBroad304_11978 pLX_304 0% 67.6% 70% V5 (many diffs) n/a
3 TRCN0000465699 CAGTTAAAACCCGCCCAATTCCAA pLX_317 24% 67.6% 70% V5 (many diffs) n/a
Download CSV