Transcript: Mouse NM_001081412.2

Mus musculus breakpoint cluster region (Bcr), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Bcr (110279)
Length:
6537
CDS:
131..3943

Additional Resources:

NCBI RefSeq record:
NM_001081412.2
NBCI Gene record:
Bcr (110279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374298 AGTCGCAACGGCAAGAGTTAC pLKO_005 2639 CDS 100% 10.800 15.120 N Bcr n/a
2 TRCN0000365984 AGACCCTTCCTGCGGTGTAAT pLKO_005 4030 3UTR 100% 13.200 10.560 N Bcr n/a
3 TRCN0000023930 GCTGACCAACTCATGTGTAAA pLKO.1 2770 CDS 100% 13.200 10.560 N Bcr n/a
4 TRCN0000023933 GCTGTTAATGTCTCCCAGCAT pLKO.1 2602 CDS 100% 2.640 2.112 N Bcr n/a
5 TRCN0000365983 ACGAGAGAAGAGAGCAAATAA pLKO_005 2524 CDS 100% 15.000 10.500 N Bcr n/a
6 TRCN0000023931 CTGAAGGACAACCTAATAAAT pLKO.1 899 CDS 100% 15.000 10.500 N Bcr n/a
7 TRCN0000374297 GCTGCCCTACATCGATGATTC pLKO_005 1492 CDS 100% 10.800 7.560 N Bcr n/a
8 TRCN0000366057 TGGTGAAGGTCAACGACAAAG pLKO_005 696 CDS 100% 10.800 7.560 N Bcr n/a
9 TRCN0000023929 CCTCCGAATCTCTCAGAACTT pLKO.1 2158 CDS 100% 4.950 3.465 N Bcr n/a
10 TRCN0000374363 TACCGAGCCTTTGTGGATAAC pLKO_005 1898 CDS 100% 0.000 0.000 N Bcr n/a
11 TRCN0000023932 GTCATCGACATGAATGGAATT pLKO.1 3182 CDS 100% 0.000 0.000 N Bcr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.