Transcript: Mouse NM_001081418.1

Mus musculus BRD4 interacting chromatin remodeling complex associated protein (Bicra), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Mus musculus (mouse)
Gene:
Bicra (243842)
Length:
5360
CDS:
108..4844

Additional Resources:

NCBI RefSeq record:
NM_001081418.1
NBCI Gene record:
Bicra (243842)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252557 CCCGCAGGATGATACACTTAC pLKO_005 4631 CDS 100% 10.800 15.120 N Bicra n/a
2 TRCN0000252555 CCTTGGGTCTGACACCTATTC pLKO_005 793 CDS 100% 10.800 15.120 N Bicra n/a
3 TRCN0000252556 GACAATTCTTGCCTAAGTTAT pLKO_005 4951 3UTR 100% 13.200 10.560 N Bicra n/a
4 TRCN0000038094 CCCAGGCCATGCTCAATAAAT pLKO.1 3580 CDS 100% 15.000 10.500 N BICRA n/a
5 TRCN0000267433 CGGTGGAGGATGAACTATATC pLKO_005 4450 CDS 100% 13.200 9.240 N Bicra n/a
6 TRCN0000252558 TCAACGGGAACTCGGTGTTTG pLKO_005 1009 CDS 100% 10.800 7.560 N Bicra n/a
7 TRCN0000430857 TTCTTGCATGGATCCGAGAAG pLKO_005 171 CDS 100% 4.050 2.835 N BICRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.