Transcript: Mouse NM_001081425.1

Mus musculus RNA binding motif protein 24 (Rbm24), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rbm24 (666794)
Length:
3224
CDS:
732..1442

Additional Resources:

NCBI RefSeq record:
NM_001081425.1
NBCI Gene record:
Rbm24 (666794)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240247 GGTCTAGATGTAGCATATTAA pLKO_005 2655 3UTR 100% 15.000 21.000 N Rbm24 n/a
2 TRCN0000240245 CTTCCACCACACCGTACATTG pLKO_005 1162 CDS 100% 10.800 8.640 N Rbm24 n/a
3 TRCN0000240243 AGCTGCTGCAGGCTATGTAAC pLKO_005 1277 CDS 100% 10.800 7.560 N Rbm24 n/a
4 TRCN0000240244 GCCCTTATCCAGAGACCTTTC pLKO_005 1056 CDS 100% 6.000 4.200 N Rbm24 n/a
5 TRCN0000240246 CCCATCATCGATGGTAGGAAG pLKO_005 951 CDS 100% 4.050 2.835 N Rbm24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05263 pDONR223 100% 69.7% 73.6% None (many diffs) n/a
2 ccsbBroad304_05263 pLX_304 0% 69.7% 73.6% V5 (many diffs) n/a
3 TRCN0000480836 CCGACGAAAAACTATTAGGTTCGT pLX_317 65.6% 69.7% 73.6% V5 (many diffs) n/a
Download CSV