Transcript: Mouse NM_001081565.3

Mus musculus synovial sarcoma, X member B8 (Ssxb8), mRNA.

Source:
NCBI, updated 2017-05-04
Taxon:
Mus musculus (mouse)
Gene:
Ssxb8 (631002)
Length:
518
CDS:
6..518

Additional Resources:

NCBI RefSeq record:
NM_001081565.3
NBCI Gene record:
Ssxb8 (631002)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081565.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239979 AGCTGACACCAGTGACAATAA pLKO_005 328 CDS 100% 13.200 7.920 N Ssxb8 n/a
2 TRCN0000239980 TAATTCCAACTTGGCAGAAAC pLKO_005 389 CDS 100% 10.800 6.480 N Ssxb8 n/a
3 TRCN0000201289 GAGGAAGTATCGAGTGATATA pLKO.1 452 CDS 100% 13.200 6.600 Y Ssxb9 n/a
4 TRCN0000226359 GAGGAAGTATCGAGTGATATA pLKO_005 452 CDS 100% 13.200 6.600 Y Gm6592 n/a
5 TRCN0000239468 TCATGACAGTGAAGATGAATG pLKO_005 266 CDS 100% 10.800 5.400 Y Ssxb5 n/a
6 TRCN0000234094 TGGCATTCAGGTCAATGTTTG pLKO_005 413 CDS 100% 10.800 5.400 Y Ssxb10 n/a
7 TRCN0000239467 TTCCAGGATATTTCTACATAC pLKO_005 78 CDS 100% 10.800 5.400 Y Ssxb5 n/a
8 TRCN0000265665 ACAGTGAAGATGAATGCTTTG pLKO_005 271 CDS 100% 6.000 3.000 Y Ssxb8 n/a
9 TRCN0000239832 CAAGGAGCAGGACAAGCAATC pLKO_005 224 CDS 100% 6.000 3.000 Y LOC639496 n/a
10 TRCN0000265670 GAAGTGCTTTATGAACCAAAG pLKO_005 42 CDS 100% 6.000 3.000 Y Ssxb8 n/a
11 TRCN0000243691 AGGCCTTCCAGGATATTTCTA pLKO_005 73 CDS 100% 5.625 2.813 Y Gm14459 n/a
12 TRCN0000243615 AGTGCCTACGTGTACATGAAA pLKO_005 141 CDS 100% 5.625 2.813 Y Gm5751 n/a
13 TRCN0000239833 TGAATGCTTTGAAGGATCTTT pLKO_005 281 CDS 100% 5.625 2.813 Y LOC639496 n/a
14 TRCN0000265658 AGGATATTTCTACATACTTCT pLKO_005 82 CDS 100% 4.950 2.475 Y Ssxb8 n/a
15 TRCN0000180536 GAAGAGGAAGAAGACGATGAT pLKO.1 492 CDS 100% 4.950 2.475 Y Ssxb2 n/a
16 TRCN0000183495 GAAGTTCATGACAGTGAAGAT pLKO.1 261 CDS 100% 4.950 2.475 Y Ssxb1 n/a
17 TRCN0000194219 GAGAGGAAGTATCGAGTGATA pLKO.1 450 CDS 100% 4.950 2.475 Y Ssxb10 n/a
18 TRCN0000243616 GCAAGGAGCAGGACAAGCAAT pLKO_005 223 CDS 100% 4.950 2.475 Y Gm5751 n/a
19 TRCN0000239978 GGTCGAAGGCATTGAAGTTCA pLKO_005 248 CDS 100% 4.950 2.475 Y Ssxb8 n/a
20 TRCN0000243694 TCACCGTGAACCAACCAGTTT pLKO_005 193 CDS 100% 4.950 2.475 Y Gm14459 n/a
21 TRCN0000426599 ACATCAGAATGACTGACCTAG pLKO_005 169 CDS 100% 4.050 2.025 Y Ssxb1 n/a
22 TRCN0000436236 GTCACCGTGAACCAACCAGTT pLKO_005 192 CDS 100% 4.050 2.025 Y Ssxb1 n/a
23 TRCN0000183952 CCTGAAGAGGAAGAAGACGAT pLKO.1 489 CDS 100% 2.640 1.320 Y Ssxb2 n/a
24 TRCN0000175333 CTACATCAGAATGACTGACCT pLKO.1 167 CDS 100% 2.640 1.320 Y Ssxb3 n/a
25 TRCN0000234095 GGAAGTATCGAGTGATATATT pLKO_005 454 CDS 100% 15.000 7.500 Y Ssxb10 n/a
26 TRCN0000180297 CCAAAGAATATCTGCAAGGCA pLKO.1 57 CDS 100% 0.750 0.375 Y Ssxb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081565.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.