Transcript: Mouse NM_001081643.1

Mus musculus X-linked lymphocyte-regulated 3B (Xlr3b), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Xlr3b (574437)
Length:
1636
CDS:
103..783

Additional Resources:

NCBI RefSeq record:
NM_001081643.1
NBCI Gene record:
Xlr3b (574437)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255206 CTTAATTCACCATGGTTTATT pLKO_005 1395 3UTR 100% 15.000 12.000 N Xlr3b n/a
2 TRCN0000255203 CTGGTAGGGAGGACATTATTT pLKO_005 230 CDS 100% 15.000 7.500 Y Xlr3b n/a
3 TRCN0000255207 GAACAGAATGAAGGAATTTAA pLKO_005 585 CDS 100% 15.000 7.500 Y Xlr3b n/a
4 TRCN0000249028 GCTGGTAGGGAGGACATTATT pLKO_005 229 CDS 100% 15.000 7.500 Y Xlr3c n/a
5 TRCN0000249030 TGCCGAAACACTCTCTAATAT pLKO_005 516 CDS 100% 15.000 7.500 Y Xlr3c n/a
6 TRCN0000255205 ATGCCGAAACACTCTCTAATA pLKO_005 515 CDS 100% 13.200 6.600 Y Xlr3b n/a
7 TRCN0000249027 CCTTGGTAGCATCGCAATTAC pLKO_005 1008 3UTR 100% 13.200 6.600 Y Xlr3c n/a
8 TRCN0000257849 TATGGAGCAACAGAAGTTTAT pLKO_005 540 CDS 100% 13.200 6.600 Y Xlr3c n/a
9 TRCN0000255204 TCGAAGAGCCACCTAACAAAG pLKO_005 308 CDS 100% 10.800 5.400 Y Xlr3b n/a
10 TRCN0000183016 CGAAACACTCTCTAATATGTT pLKO.1 519 CDS 100% 5.625 2.813 Y Xlr3a n/a
11 TRCN0000191756 GCATACAAACTCAAGAAACAT pLKO.1 496 CDS 100% 5.625 2.813 Y Xlr3c n/a
12 TRCN0000179132 GCCACCTTGGAAATCAAACTT pLKO.1 694 CDS 100% 5.625 2.813 Y Xlr3a n/a
13 TRCN0000179260 GCTAACAGAGAAGTCCTTGAT pLKO.1 208 CDS 100% 4.950 2.475 Y Xlr3a n/a
14 TRCN0000183771 CCTAACAAAGTTCTTCAGGAA pLKO.1 319 CDS 100% 2.640 1.320 Y Xlr3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.