Transcript: Mouse NM_001082536.1

Mus musculus MKL (megakaryoblastic leukemia)/myocardin-like 1 (Mkl1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mkl1 (223701)
Length:
4366
CDS:
573..3362

Additional Resources:

NCBI RefSeq record:
NM_001082536.1
NBCI Gene record:
Mkl1 (223701)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001082536.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086206 CGAGGACTATTTGAAACGGAA pLKO.1 638 CDS 100% 2.640 3.696 N Mkl1 n/a
2 TRCN0000086205 CAGGTAAATTACCCAAAGGTA pLKO.1 879 CDS 100% 3.000 2.400 N Mkl1 n/a
3 TRCN0000321563 ATCATTGTGGGCCAGGTAAAT pLKO_005 867 CDS 100% 13.200 9.240 N Mkl1 n/a
4 TRCN0000321560 ATCCTCACTGTGACCAATAAG pLKO_005 2568 CDS 100% 13.200 9.240 N Mkl1 n/a
5 TRCN0000350639 CAGTCTTGGTGTATAGTATAA pLKO_005 3763 3UTR 100% 13.200 9.240 N Mkl1 n/a
6 TRCN0000321561 AGCACATGGATGATCTGTTTG pLKO_005 2803 CDS 100% 10.800 7.560 N Mkl1 n/a
7 TRCN0000321559 ATCACCCACTCAGGTTCTTTC pLKO_005 1037 CDS 100% 10.800 7.560 N Mkl1 n/a
8 TRCN0000086203 CCCACTCAGGTTCTTTCTCAA pLKO.1 1041 CDS 100% 4.950 3.465 N Mkl1 n/a
9 TRCN0000086204 GTGACCAATAAGAGTGCTGAT pLKO.1 2577 CDS 100% 4.050 2.835 N Mkl1 n/a
10 TRCN0000086207 CAGATTTCAAAGAGCCACCAT pLKO.1 2854 CDS 100% 2.640 1.848 N Mkl1 n/a
11 TRCN0000083567 GCTCAAGTACCACCAGTACAT pLKO.1 1277 CDS 100% 4.950 2.970 N MRTFA n/a
12 TRCN0000299978 GCTCAAGTACCACCAGTACAT pLKO_005 1277 CDS 100% 4.950 2.970 N MRTFA n/a
13 TRCN0000085244 CCAAAGGTGAAGAAGCTCAAA pLKO.1 1263 CDS 100% 4.950 2.475 Y Myocd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001082536.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.