Transcript: Mouse NM_001082543.1

Mus musculus stefin A1 (Stfa1), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Mus musculus (mouse)
Gene:
Stfa1 (20861)
Length:
418
CDS:
49..342

Additional Resources:

NCBI RefSeq record:
NM_001082543.1
NBCI Gene record:
Stfa1 (20861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001082543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253360 TTCGAAGCCGTTGAGTATAAA pLKO_005 160 CDS 100% 15.000 7.500 Y Stfa1 n/a
2 TRCN0000265387 ATGGTTGTTTCATTCACATAA pLKO_005 230 CDS 100% 13.200 6.600 Y Stfa1 n/a
3 TRCN0000262726 ATTCGAAGCCGTTGAGTATAA pLKO_005 159 CDS 100% 13.200 6.600 Y BC100530 n/a
4 TRCN0000262722 TGGTTGTTTCATTCACATAAA pLKO_005 231 CDS 100% 13.200 6.600 Y BC100530 n/a
5 TRCN0000253362 CACCAGAAATCCAGATGATTG pLKO_005 86 CDS 100% 10.800 5.400 Y Stfa1 n/a
6 TRCN0000079983 GTAGGTCATGGTTGTTTCATT pLKO.1 223 CDS 100% 5.625 2.813 Y BC117090 n/a
7 TRCN0000080001 CACACCAGAAATCCAGATGAT pLKO.1 84 CDS 100% 4.950 2.475 Y Stfa3 n/a
8 TRCN0000253363 CAGACCTCAGCTTGAAGCAAA pLKO_005 117 CDS 100% 4.950 2.475 Y Stfa1 n/a
9 TRCN0000079986 CATGGTTGTTTCATTCACATA pLKO.1 229 CDS 100% 4.950 2.475 Y BC117090 n/a
10 TRCN0000262725 CTTCAATGGACCTACTGGAAA pLKO_005 255 CDS 100% 4.950 2.475 Y BC100530 n/a
11 TRCN0000253361 TCTTCATTAAGATGGATGTAG pLKO_005 206 CDS 100% 4.950 2.475 Y Stfa1 n/a
12 TRCN0000262723 AGCCGTGCCACACCAGAAATC pLKO_005 76 CDS 100% 3.600 1.800 Y BC100530 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001082543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.