Transcript: Mouse NM_001082546.1

Mus musculus cDNA sequence BC100530 (BC100530), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
BC100530 (100034684)
Length:
453
CDS:
70..363

Additional Resources:

NCBI RefSeq record:
NM_001082546.1
NBCI Gene record:
BC100530 (100034684)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001082546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253360 TTCGAAGCCGTTGAGTATAAA pLKO_005 181 CDS 100% 15.000 7.500 Y Stfa1 n/a
2 TRCN0000265387 ATGGTTGTTTCATTCACATAA pLKO_005 251 CDS 100% 13.200 6.600 Y Stfa1 n/a
3 TRCN0000262726 ATTCGAAGCCGTTGAGTATAA pLKO_005 180 CDS 100% 13.200 6.600 Y BC100530 n/a
4 TRCN0000262722 TGGTTGTTTCATTCACATAAA pLKO_005 252 CDS 100% 13.200 6.600 Y BC100530 n/a
5 TRCN0000079983 GTAGGTCATGGTTGTTTCATT pLKO.1 244 CDS 100% 5.625 2.813 Y BC117090 n/a
6 TRCN0000079984 CACACCAGAAATCCAGAAGAT pLKO.1 105 CDS 100% 4.950 2.475 Y BC117090 n/a
7 TRCN0000253363 CAGACCTCAGCTTGAAGCAAA pLKO_005 138 CDS 100% 4.950 2.475 Y Stfa1 n/a
8 TRCN0000079986 CATGGTTGTTTCATTCACATA pLKO.1 250 CDS 100% 4.950 2.475 Y BC117090 n/a
9 TRCN0000262725 CTTCAATGGACCTACTGGAAA pLKO_005 276 CDS 100% 4.950 2.475 Y BC100530 n/a
10 TRCN0000253361 TCTTCATTAAGATGGATGTAG pLKO_005 227 CDS 100% 4.950 2.475 Y Stfa1 n/a
11 TRCN0000262724 AGATTGCTGACAAGGTCAGAC pLKO_005 122 CDS 100% 4.050 2.025 Y BC100530 n/a
12 TRCN0000262723 AGCCGTGCCACACCAGAAATC pLKO_005 97 CDS 100% 3.600 1.800 Y BC100530 n/a
13 TRCN0000079987 CCAGAAGATTGCTGACAAGGT pLKO.1 117 CDS 100% 2.640 1.320 Y BC117090 n/a
14 TRCN0000079985 ACTCAAGCCGTCGCTGGAGAA pLKO.1 202 CDS 100% 1.350 0.675 Y BC117090 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001082546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.