Transcript: Mouse NM_001083121.2

Mus musculus enabled homolog (Drosophila) (Enah), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Enah (13800)
Length:
11548
CDS:
447..2072

Additional Resources:

NCBI RefSeq record:
NM_001083121.2
NBCI Gene record:
Enah (13800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001083121.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091679 CATGCCTTAGAAGTGTTAAAT pLKO.1 762 CDS 100% 15.000 12.000 N Enah n/a
2 TRCN0000312161 CATGCCTTAGAAGTGTTAAAT pLKO_005 762 CDS 100% 15.000 12.000 N Enah n/a
3 TRCN0000091682 GAGCAAGTCGAACACTGCATA pLKO.1 2051 CDS 100% 4.950 3.960 N Enah n/a
4 TRCN0000312163 GAGCAAGTCGAACACTGCATA pLKO_005 2051 CDS 100% 4.950 3.960 N Enah n/a
5 TRCN0000091680 CAGAAGACAATCGCCCTTTAA pLKO.1 1507 CDS 100% 13.200 9.240 N Enah n/a
6 TRCN0000312162 CAGAAGACAATCGCCCTTTAA pLKO_005 1507 CDS 100% 13.200 9.240 N Enah n/a
7 TRCN0000370690 GCATGCCTTAGAAGTGTTAAA pLKO_005 761 CDS 100% 13.200 9.240 N ENAH n/a
8 TRCN0000303551 AGGTGTATGGTCTCAACTTTG pLKO_005 700 CDS 100% 10.800 7.560 N ENAH n/a
9 TRCN0000091678 GCAGGACTTGAATCTGGAGAA pLKO.1 2092 3UTR 100% 4.050 2.835 N Enah n/a
10 TRCN0000349368 GCAGGACTTGAATCTGGAGAA pLKO_005 2092 3UTR 100% 4.050 2.835 N Enah n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083121.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.