Transcript: Mouse NM_001083917.1

Mus musculus sodium channel, voltage-gated, type III, beta (Scn3b), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Scn3b (235281)
Length:
4177
CDS:
413..1060

Additional Resources:

NCBI RefSeq record:
NM_001083917.1
NBCI Gene record:
Scn3b (235281)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001083917.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069248 GCGGTAAAGATTTCCTTATAT pLKO.1 615 CDS 100% 15.000 21.000 N Scn3b n/a
2 TRCN0000069249 CGTATCCATCACTGTTCTCAA pLKO.1 718 CDS 100% 4.950 6.930 N Scn3b n/a
3 TRCN0000069251 CTCGGAAATCATGATGTACAT pLKO.1 883 CDS 100% 4.950 3.960 N Scn3b n/a
4 TRCN0000069250 GCAATTCCATGAAGCTGAGAT pLKO.1 525 CDS 100% 4.950 3.465 N Scn3b n/a
5 TRCN0000069252 GTTCTCAATGTCACTCTGAAT pLKO.1 731 CDS 100% 4.950 3.465 N Scn3b n/a
6 TRCN0000044633 GCGGTAAAGATTTCCTTATTT pLKO.1 615 CDS 100% 15.000 21.000 N SCN3B n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3789 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083917.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03656 pDONR223 100% 89.4% 97.6% None (many diffs) n/a
2 ccsbBroad304_03656 pLX_304 0% 89.4% 97.6% V5 (many diffs) n/a
Download CSV