Transcript: Human NM_001085375.2

Homo sapiens chromosome 1 open reading frame 226 (C1orf226), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
C1orf226 (400793)
Length:
4122
CDS:
175..993

Additional Resources:

NCBI RefSeq record:
NM_001085375.2
NBCI Gene record:
C1orf226 (400793)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001085375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264182 TGCAATCCATCAGCGTTTAAA pLKO_005 3965 3UTR 100% 15.000 21.000 N C1orf226 n/a
2 TRCN0000264183 CCTGTCAGTACCTGACCTAAT pLKO_005 762 CDS 100% 10.800 15.120 N C1orf226 n/a
3 TRCN0000264181 CCACCCAGGACATGCTGATTT pLKO_005 572 CDS 100% 13.200 9.240 N C1orf226 n/a
4 TRCN0000264184 TGGATCCTCCACCTCCCATAA pLKO_005 521 CDS 100% 10.800 7.560 N C1orf226 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05639 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05639 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480974 TATACCGTTTCTAGTAAATTTTTT pLX_317 46.9% 100% 100% V5 n/a
Download CSV