Transcript: Mouse NM_001085416.1

Mus musculus zinc finger protein 467 (Zfp467), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp467 (68910)
Length:
3179
CDS:
163..498

Additional Resources:

NCBI RefSeq record:
NM_001085416.1
NBCI Gene record:
Zfp467 (68910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001085416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085855 GCCCGCTGCTTCAGCTCTAAA pLKO.1 1623 3UTR 100% 4.400 3.520 N Zfp467 n/a
2 TRCN0000085853 GCCATTTCTTTAATTGTCCTT pLKO.1 1968 3UTR 100% 2.640 2.112 N Zfp467 n/a
3 TRCN0000085854 CGAGAAACGTTTCCGCAAGAA pLKO.1 896 3UTR 100% 4.950 3.465 N Zfp467 n/a
4 TRCN0000085857 GAAGGCATCCACACAGAACAA pLKO.1 334 CDS 100% 4.950 3.465 N Zfp467 n/a
5 TRCN0000085856 TGACAGATTTGGGAGACTCAT pLKO.1 1881 3UTR 100% 4.950 3.465 N Zfp467 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.