Transcript: Human NM_001085451.2

Homo sapiens leukemia NUP98 fusion partner 1 (LNP1), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LNP1 (348801)
Length:
1864
CDS:
935..1471

Additional Resources:

NCBI RefSeq record:
NM_001085451.2
NBCI Gene record:
LNP1 (348801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001085451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247668 CATCTTAGTTGAGAGTATAAT pLKO_005 1675 3UTR 100% 15.000 21.000 N LNP1 n/a
2 TRCN0000247670 TCTCATGAGGACCAAGAATTT pLKO_005 1142 CDS 100% 13.200 9.240 N LNP1 n/a
3 TRCN0000247671 TACTCAGAGGATGGGTCATTC pLKO_005 1196 CDS 100% 10.800 7.560 N LNP1 n/a
4 TRCN0000247669 TTGAACGGCAACTGTGCTTTA pLKO_005 1278 CDS 100% 10.800 7.560 N LNP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05517 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05517 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471026 CTGTGATACCCGGAGTTTCGTACA pLX_317 86.5% 100% 100% V5 n/a
Download CSV