Transcript: Human NM_001090.3

Homo sapiens ATP binding cassette subfamily F member 1 (ABCF1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ABCF1 (23)
Length:
3291
CDS:
47..2470

Additional Resources:

NCBI RefSeq record:
NM_001090.3
NBCI Gene record:
ABCF1 (23)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001090.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155496 CGCTGTCATCTGGCTTAATAA pLKO.1 1387 CDS 100% 15.000 21.000 N ABCF1 n/a
2 TRCN0000343674 CGCTGTCATCTGGCTTAATAA pLKO_005 1387 CDS 100% 15.000 21.000 N ABCF1 n/a
3 TRCN0000157280 GCCAACCAATAACCTGGACAT pLKO.1 2236 CDS 100% 4.050 5.670 N ABCF1 n/a
4 TRCN0000158181 CAACGCTGTCATCTGGCTTAA pLKO.1 1384 CDS 100% 10.800 8.640 N ABCF1 n/a
5 TRCN0000155328 GCCAAGTTTATGTGGCCTATT pLKO.1 2757 3UTR 100% 10.800 8.640 N ABCF1 n/a
6 TRCN0000343675 GCCAAGTTTATGTGGCCTATT pLKO_005 2757 3UTR 100% 10.800 8.640 N ABCF1 n/a
7 TRCN0000157411 GCAGAGTGTTAGCCAAATCGA pLKO.1 2374 CDS 100% 3.000 2.400 N ABCF1 n/a
8 TRCN0000352889 GCAGAGTGTTAGCCAAATCGA pLKO_005 2374 CDS 100% 3.000 2.400 N ABCF1 n/a
9 TRCN0000156162 CGGAGAAGAATCGGATCAATA pLKO.1 513 CDS 100% 13.200 9.240 N ABCF1 n/a
10 TRCN0000343673 CGGAGAAGAATCGGATCAATA pLKO_005 513 CDS 100% 13.200 9.240 N ABCF1 n/a
11 TRCN0000156300 CCCTCCCAACATTGATGTGTT pLKO.1 1000 CDS 100% 4.950 3.465 N ABCF1 n/a
12 TRCN0000157441 GCAACCATTCAGGCACATGAA pLKO.1 2574 3UTR 100% 4.950 3.465 N ABCF1 n/a
13 TRCN0000157281 GCGTCTTAAGAAGCTCTCAGT pLKO.1 343 CDS 100% 2.640 1.848 N ABCF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001090.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.