Transcript: Human NM_001094.4

Homo sapiens acid sensing ion channel subunit 2 (ASIC2), transcript variant MDEG1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
ASIC2 (40)
Length:
2747
CDS:
275..1813

Additional Resources:

NCBI RefSeq record:
NM_001094.4
NBCI Gene record:
ASIC2 (40)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001094.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068471 GCTAGTATCCTTACAATACTA pLKO.1 1598 CDS 100% 0.563 0.788 N Asic2 n/a
2 TRCN0000422694 GAGACAGAGGAAACGACATTT pLKO_005 974 CDS 100% 13.200 9.240 N ASIC2 n/a
3 TRCN0000044824 GCTGCCTTACTTGGTGATATT pLKO.1 1550 CDS 100% 13.200 9.240 N ASIC2 n/a
4 TRCN0000422270 TGATCAAAGAGAAGCTATTAG pLKO_005 1644 CDS 100% 13.200 9.240 N ASIC2 n/a
5 TRCN0000044827 CCTTCTAGCATCCAGATCTTT pLKO.1 314 CDS 100% 5.625 3.938 N ASIC2 n/a
6 TRCN0000044826 GCCAAGTACCTTGAGAAGAAA pLKO.1 1424 CDS 100% 5.625 3.938 N ASIC2 n/a
7 TRCN0000044825 CCAAGACTTCACCACAGTGTT pLKO.1 814 CDS 100% 4.950 3.465 N ASIC2 n/a
8 TRCN0000068469 GCGTATGAAGTTGCTGCCTTA pLKO.1 1538 CDS 100% 4.050 2.835 N Asic2 n/a
9 TRCN0000044823 GCTCTCAATTATGAGACAATT pLKO.1 1505 CDS 100% 1.320 0.924 N ASIC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001094.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.