Transcript: Human NM_001098621.3

Homo sapiens transmembrane protein 251 (TMEM251), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TMEM251 (26175)
Length:
2713
CDS:
433..924

Additional Resources:

NCBI RefSeq record:
NM_001098621.3
NBCI Gene record:
TMEM251 (26175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098621.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282946 GTGATTAGGGAGCTATCTTTA pLKO_005 1050 3UTR 100% 13.200 18.480 N TMEM251 n/a
2 TRCN0000264214 CTATATGCTTGGCAGTTATTT pLKO_005 836 CDS 100% 15.000 12.000 N TMEM251 n/a
3 TRCN0000264212 ACACTCCTTGAAAGCTCAATT pLKO_005 696 CDS 100% 13.200 9.240 N TMEM251 n/a
4 TRCN0000174855 GCATTTGTCAAGGCTTCTAAT pLKO.1 871 CDS 100% 13.200 9.240 N Tmem251 n/a
5 TRCN0000264211 TCAGAGCTGAGTGACTCTTTA pLKO_005 454 CDS 100% 13.200 9.240 N TMEM251 n/a
6 TRCN0000264213 TACAACTGATTGACACGTAAA pLKO_005 905 CDS 100% 10.800 7.560 N TMEM251 n/a
7 TRCN0000217568 GAGCATGGAGAATGATGAACT pLKO.1 518 CDS 100% 4.950 3.465 N Tmem251 n/a
8 TRCN0000194088 GCTTCTAATCAGATCAGCAGA pLKO.1 883 CDS 100% 2.640 1.848 N Tmem251 n/a
9 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2432 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098621.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.