Transcript: Human NM_001098802.3

Homo sapiens centrosomal protein 78 (CEP78), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CEP78 (84131)
Length:
2758
CDS:
277..2445

Additional Resources:

NCBI RefSeq record:
NM_001098802.3
NBCI Gene record:
CEP78 (84131)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072684 GCTGGGATAGATCAGTCAGAT pLKO.1 1927 CDS 100% 4.950 3.960 N CEP78 n/a
2 TRCN0000072685 CCTGCGATAAGATACAAAGAT pLKO.1 565 CDS 100% 5.625 3.938 N CEP78 n/a
3 TRCN0000072686 CCTCACCAATGAAGGAGCAAA pLKO.1 1077 CDS 100% 4.950 3.465 N CEP78 n/a
4 TRCN0000072687 CCAGGTTTCTATTTGTATGCA pLKO.1 2073 CDS 100% 3.000 2.100 N CEP78 n/a
5 TRCN0000072683 GCAAAGAAACTAGGGAAACTA pLKO.1 2471 3UTR 100% 5.625 3.375 N CEP78 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.