Transcript: Human NM_001099404.1

Homo sapiens sodium voltage-gated channel alpha subunit 5 (SCN5A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
SCN5A (6331)
Length:
8504
CDS:
195..6245

Additional Resources:

NCBI RefSeq record:
NM_001099404.1
NBCI Gene record:
SCN5A (6331)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001099404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437014 CACTAGAGCCACCAGCGATAA pLKO_005 6134 CDS 100% 10.800 15.120 N SCN5A n/a
2 TRCN0000444826 TGTCCCGCATGAGCAACTTGT pLKO_005 2587 CDS 100% 4.950 6.930 N SCN5A n/a
3 TRCN0000438207 CAGTGAAGATCTCGCCGACTT pLKO_005 6185 CDS 100% 4.050 5.670 N SCN5A n/a
4 TRCN0000437343 GTTAGAGGAGTCTCGCCACAA pLKO_005 2219 CDS 100% 4.050 5.670 N SCN5A n/a
5 TRCN0000043868 GCCGACAAGATGTTCACATAT pLKO.1 3918 CDS 100% 13.200 9.240 N SCN5A n/a
6 TRCN0000043870 GCTGGACTTTAGTGTGATTAT pLKO.1 779 CDS 100% 13.200 9.240 N SCN5A n/a
7 TRCN0000438284 AGAGGTGTCGGCCATGGTTAT pLKO_005 5897 CDS 100% 10.800 7.560 N SCN5A n/a
8 TRCN0000043872 CGAGACATTCATCATCTTCAT pLKO.1 3815 CDS 100% 4.950 3.465 N SCN5A n/a
9 TRCN0000043871 GCCATCATCGTGTTCATCTTT pLKO.1 2733 CDS 100% 5.625 3.375 N SCN5A n/a
10 TRCN0000043869 CCACTCAGTTTATTGAGTATT pLKO.1 5608 CDS 100% 1.320 0.792 N SCN5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.