Transcript: Mouse NM_001100183.1

Mus musculus cytochrome P450, family 4, subfamily a, polypeptide 29 (Cyp4a29), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Cyp4a29 (230639)
Length:
1530
CDS:
1..1530

Additional Resources:

NCBI RefSeq record:
NM_001100183.1
NBCI Gene record:
Cyp4a29 (230639)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001100183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253206 ATACCATCTGTTGGCAGAAAG pLKO_005 1153 CDS 100% 10.800 8.640 N Cyp4a29 n/a
2 TRCN0000253208 GGCATTGCTTGCAGTTCAAAG pLKO_005 182 CDS 100% 10.800 8.640 N Cyp4a29 n/a
3 TRCN0000253205 TTCCTCCACAATGACATTATC pLKO_005 703 CDS 100% 13.200 9.240 N Cyp4a29 n/a
4 TRCN0000253207 ACACTATCTGCGCAGACAATG pLKO_005 108 CDS 100% 10.800 7.560 N Cyp4a29 n/a
5 TRCN0000253204 TCCTGGACATCCTTCTATTAT pLKO_005 869 CDS 100% 15.000 9.000 N Cyp4a29 n/a
6 TRCN0000125891 CCCTGACTACATGAAAGTGAT pLKO.1 303 CDS 100% 4.950 2.475 Y Cyp4a10 n/a
7 TRCN0000125890 CCTGACTACATGAAAGTGATT pLKO.1 304 CDS 100% 4.950 2.475 Y Cyp4a10 n/a
8 TRCN0000191430 CCTGACTACATGAAAGTGATT pLKO.1 304 CDS 100% 4.950 2.475 Y Cyp4a31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001100183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.