Transcript: Mouse NM_001101433.1

Mus musculus zinc finger, CCHC domain containing 24 (Zcchc24), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Zcchc24 (71918)
Length:
4375
CDS:
1..726

Additional Resources:

NCBI RefSeq record:
NM_001101433.1
NBCI Gene record:
Zcchc24 (71918)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001101433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267607 GCCCTACGGTTCCCTCAATAA pLKO_005 279 CDS 100% 13.200 10.560 N Zcchc24 n/a
2 TRCN0000254364 CCTGCACTCCAGTTATCTTAA pLKO_005 198 CDS 100% 13.200 9.240 N Zcchc24 n/a
3 TRCN0000254365 GCTGCTTTGGCGAGTACAAGT pLKO_005 494 CDS 100% 4.950 3.465 N Zcchc24 n/a
4 TRCN0000254367 AGCTAGCTGCAGGGTAGATTT pLKO_005 2287 3UTR 100% 13.200 7.920 N Zcchc24 n/a
5 TRCN0000254366 TACCTGTGCCACCTGTGTTTC pLKO_005 394 CDS 100% 0.000 0.000 N Zcchc24 n/a
6 TRCN0000315354 AGTGCCACATCAACGTGTATC pLKO_005 581 CDS 100% 10.800 15.120 N ZCCHC24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09842 pDONR223 100% 91.9% 97.5% None (many diffs) n/a
2 ccsbBroad304_09842 pLX_304 0% 91.9% 97.5% V5 (many diffs) n/a
3 TRCN0000468601 TGCGTCCATACAGTAGTGACATTC pLX_317 56.6% 91.9% 97.5% V5 (many diffs) n/a
Download CSV