Transcript: Mouse NM_001103153.1

Mus musculus predicted gene 10334 (Gm10334), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Gm10334 (100040233)
Length:
830
CDS:
33..773

Additional Resources:

NCBI RefSeq record:
NM_001103153.1
NBCI Gene record:
Gm10334 (100040233)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001103153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272159 ATGGAGAGCTCCAGGGTATAG pLKO_005 652 CDS 100% 10.800 6.480 N Gm10334 n/a
2 TRCN0000272161 ACCCGCATCCAAGTGAGATTG pLKO_005 231 CDS 100% 10.800 5.400 Y Gm10334 n/a
3 TRCN0000281864 GCAATGAGCAGTTTGTCAATG pLKO_005 280 CDS 100% 10.800 5.400 Y Gm10334 n/a
4 TRCN0000284639 CAAGATCGTTGGAGGATACAC pLKO_005 98 CDS 100% 4.950 2.475 Y Gm10334 n/a
5 TRCN0000031947 CAATAGGAAGACACTGAACAA pLKO.1 329 CDS 100% 4.950 2.475 Y Prss3 n/a
6 TRCN0000031948 CGTGGATGATGATGACAAGAT pLKO.1 83 CDS 100% 4.950 2.475 Y Prss3 n/a
7 TRCN0000031945 CTTAGCTTTGGTGTCAGTGAA pLKO.1 474 CDS 100% 4.950 2.475 Y Prss3 n/a
8 TRCN0000087271 GCTGACTGTGAAGCCTCCTAT pLKO.1 537 CDS 100% 4.950 2.475 Y Gm5771 n/a
9 TRCN0000031972 TCCTGGGAAGATCACTGGTAA pLKO.1 557 CDS 100% 4.950 2.475 Y Prss1 n/a
10 TRCN0000272160 ACGACATCATGTTGATCAAGC pLKO_005 349 CDS 100% 4.050 2.025 Y Gm10334 n/a
11 TRCN0000087268 GCAGTTTGTCAATGCTGCCAA pLKO.1 287 CDS 100% 2.640 1.320 Y Gm5771 n/a
12 TRCN0000031970 TCTTAGCTTTGGTGTCAGTGA pLKO.1 473 CDS 100% 2.640 1.320 Y Prss1 n/a
13 TRCN0000092386 TGGAGGGCAATGAGCAGTTTA pLKO.1 274 CDS 100% 13.200 6.600 Y Try10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001103153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.