Transcript: Mouse NM_001103367.1

Mus musculus retinoic acid induced 2 (Rai2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rai2 (24004)
Length:
2198
CDS:
257..1846

Additional Resources:

NCBI RefSeq record:
NM_001103367.1
NBCI Gene record:
Rai2 (24004)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001103367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246648 CCCTCCCACTTTGGCTAATAA pLKO_005 304 CDS 100% 15.000 21.000 N Rai2 n/a
2 TRCN0000246649 GCAAATTAGCTAGTATCATTT pLKO_005 1974 3UTR 100% 13.200 18.480 N Rai2 n/a
3 TRCN0000257547 GGCAACGCTACCTACGTTATG pLKO_005 578 CDS 100% 10.800 15.120 N Rai2 n/a
4 TRCN0000145309 CCGGAGCATAAAGTTAAAGAA pLKO.1 1753 CDS 100% 5.625 7.875 N RAI2 n/a
5 TRCN0000246647 CCTCCAGTCAAAGGAGTATTT pLKO_005 1135 CDS 100% 13.200 10.560 N Rai2 n/a
6 TRCN0000217313 GAAGCTGTGCTCCAGAATTTA pLKO.1 809 CDS 100% 15.000 10.500 N Rai2 n/a
7 TRCN0000200452 GTGGGAGCAGAAAGGCAAATT pLKO.1 1960 3UTR 100% 13.200 9.240 N Rai2 n/a
8 TRCN0000413054 TGCAGCTTTAATGGAATATTG pLKO_005 2070 3UTR 100% 13.200 9.240 N RAI2 n/a
9 TRCN0000246646 CCTTCGGCTTGCACTCCTTTA pLKO_005 1065 CDS 100% 10.800 7.560 N Rai2 n/a
10 TRCN0000121887 GAGTAAATAAGAGCAACCTAT pLKO.1 2024 3UTR 100% 4.950 3.465 N RAI2 n/a
11 TRCN0000145332 GCTAATAACAGACTGGAGAAT pLKO.1 317 CDS 100% 4.950 3.960 N RAI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001103367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07673 pDONR223 100% 87.6% 89.6% None (many diffs) n/a
2 ccsbBroad304_07673 pLX_304 0% 87.6% 89.6% V5 (many diffs) n/a
Download CSV