Transcript: Human NM_001105580.2

Homo sapiens gamma-aminobutyric acid type A receptor rho3 subunit (gene/pseudogene) (GABRR3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
GABRR3 (200959)
Length:
1521
CDS:
118..1521

Additional Resources:

NCBI RefSeq record:
NM_001105580.2
NBCI Gene record:
GABRR3 (200959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001105580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048636 CCATGATACAACTATGGAGAA pLKO.1 579 CDS 100% 4.050 5.670 N GABRR3 n/a
2 TRCN0000048637 CCAGTAGGTATAGATGTCCAT pLKO.1 367 CDS 100% 2.640 3.696 N GABRR3 n/a
3 TRCN0000048633 GCACCGATTCATCTCGGATAA pLKO.1 1364 CDS 100% 10.800 8.640 N GABRR3 n/a
4 TRCN0000048635 CCCAGCCATATTGATGGTGAT pLKO.1 945 CDS 100% 4.050 3.240 N GABRR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001105580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.