Transcript: Human NM_001109662.4

Homo sapiens HECT domain E3 ubiquitin protein ligase 4 (HECTD4), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
HECTD4 (283450)
Length:
15782
CDS:
304..13590

Additional Resources:

NCBI RefSeq record:
NM_001109662.4
NBCI Gene record:
HECTD4 (283450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001109662.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237815 TGCGGAAGACACCCATATATA pLKO_005 1865 CDS 100% 15.000 21.000 N HECTD4 n/a
2 TRCN0000244301 CCCTATCGCTTGCGCAAATAG pLKO_005 5385 CDS 100% 13.200 18.480 N HECTD4 n/a
3 TRCN0000004994 CGCTGCCTGTACCTTAGATTT pLKO.1 3574 CDS 100% 13.200 18.480 N HECTD4 n/a
4 TRCN0000052740 CGCTGGAAGGATTTCACAAAT pLKO.1 11825 CDS 100% 13.200 18.480 N HECTD4 n/a
5 TRCN0000174202 CGCTGGAAGGATTTCACAAAT pLKO.1 11825 CDS 100% 13.200 18.480 N HECTD4 n/a
6 TRCN0000237814 GCGTCAGACACATTGACTATT pLKO_005 6964 CDS 100% 13.200 18.480 N HECTD4 n/a
7 TRCN0000004996 GCCCTCATAAATAGTGACATA pLKO.1 3139 CDS 100% 4.950 6.930 N HECTD4 n/a
8 TRCN0000052741 CCTCACCTACAATTACGTCAA pLKO.1 12834 CDS 100% 4.050 5.670 N HECTD4 n/a
9 TRCN0000052742 GCTCTCGATATTTATCCACAA pLKO.1 6183 CDS 100% 4.050 5.670 N HECTD4 n/a
10 TRCN0000004995 CCTCAATTTAGACCAAGTATA pLKO.1 4261 CDS 100% 13.200 10.560 N HECTD4 n/a
11 TRCN0000052738 CCCACCATTGAAGACATTAAA pLKO.1 8542 CDS 100% 15.000 10.500 N HECTD4 n/a
12 TRCN0000237817 GATGGCAAGCTCTCGATATTT pLKO_005 6175 CDS 100% 15.000 10.500 N HECTD4 n/a
13 TRCN0000237816 TGAAAGAGCCTTTCGATTTAT pLKO_005 15263 3UTR 100% 15.000 10.500 N HECTD4 n/a
14 TRCN0000004993 CGCTGCATTCTCGTTGTCTTT pLKO.1 2455 CDS 100% 4.950 3.465 N HECTD4 n/a
15 TRCN0000052739 GCCTCTTCATAAACTGTCCAT pLKO.1 7023 CDS 100% 2.640 1.848 N HECTD4 n/a
16 TRCN0000255328 CGATGATGATGACGATGATAA pLKO_005 8307 CDS 100% 13.200 6.600 Y Sbpl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001109662.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.