Transcript: Mouse NM_001109764.1

Mus musculus catenin (cadherin associated protein), alpha 2 (Ctnna2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ctnna2 (12386)
Length:
4148
CDS:
356..3217

Additional Resources:

NCBI RefSeq record:
NM_001109764.1
NBCI Gene record:
Ctnna2 (12386)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001109764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108889 CCGGGTCATTCACATCATCAA pLKO.1 1999 CDS 100% 4.950 6.930 N Ctnna2 n/a
2 TRCN0000108885 CCCGTCTCAAATGTTTCTTTA pLKO.1 3769 3UTR 100% 13.200 10.560 N Ctnna2 n/a
3 TRCN0000108887 CGGGTCATTCACATCATCAAT pLKO.1 2000 CDS 100% 5.625 4.500 N Ctnna2 n/a
4 TRCN0000108888 CGTCTTATGTAGCCTCAACTA pLKO.1 3000 CDS 100% 4.950 3.960 N Ctnna2 n/a
5 TRCN0000108886 GCCCTGAATGAGTTTGATAAT pLKO.1 1190 CDS 100% 13.200 9.240 N Ctnna2 n/a
6 TRCN0000147992 GAGGTAGATTGTGATGTCATA pLKO.1 2819 CDS 100% 4.950 3.465 N CTNNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001109764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06063 pDONR223 100% 85.8% 94.8% None (many diffs) n/a
2 ccsbBroad304_06063 pLX_304 0% 85.8% 94.8% V5 (many diffs) n/a
Download CSV