Transcript: Mouse NM_001109873.1

Mus musculus core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human) (Cbfa2t3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cbfa2t3 (12398)
Length:
7678
CDS:
341..2098

Additional Resources:

NCBI RefSeq record:
NM_001109873.1
NBCI Gene record:
Cbfa2t3 (12398)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001109873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096433 CTGACGATCGAAGAGTTTCAT pLKO.1 791 CDS 100% 5.625 7.875 N Cbfa2t3 n/a
2 TRCN0000096429 GCAAACAAGCTACTTAGAAAT pLKO.1 2583 3UTR 100% 13.200 9.240 N Cbfa2t3 n/a
3 TRCN0000096430 CGACAAGAAGAAGTGATTGAT pLKO.1 1298 CDS 100% 5.625 3.938 N Cbfa2t3 n/a
4 TRCN0000096431 GAGGCCGTTTGTTATCCCTTT pLKO.1 844 CDS 100% 4.050 2.835 N Cbfa2t3 n/a
5 TRCN0000096432 CTGACTGTCATCAACCAGCAA pLKO.1 1793 CDS 100% 2.640 1.848 N Cbfa2t3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001109873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.