Transcript: Mouse NM_001110223.1

Mus musculus doublecortin (Dcx), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Dcx (13193)
Length:
9000
CDS:
173..1273

Additional Resources:

NCBI RefSeq record:
NM_001110223.1
NBCI Gene record:
Dcx (13193)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105976 CGCGTGCTTCTCAACAAGAAA pLKO.1 758 CDS 100% 5.625 7.875 N Dcx n/a
2 TRCN0000105975 CGGCTGTAATTGGTGGTTGTA pLKO.1 7952 3UTR 100% 4.950 3.960 N Dcx n/a
3 TRCN0000105977 CCCAAACTTGTGACCATCATT pLKO.1 707 CDS 100% 5.625 3.938 N Dcx n/a
4 TRCN0000105979 TCCGCTATGCTCAAGATGATT pLKO.1 942 CDS 100% 5.625 3.938 N Dcx n/a
5 TRCN0000083227 CCAACTGGTCTGTCAACGTAA pLKO.1 603 CDS 100% 4.950 3.465 N DCX n/a
6 TRCN0000105978 GCAGGCATTAAGTAATGAGAA pLKO.1 301 CDS 100% 4.950 3.465 N Dcx n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4014 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00428 pDONR223 100% 88.2% 97.8% None (many diffs) n/a
2 ccsbBroad304_00428 pLX_304 0% 88.2% 97.8% V5 (many diffs) n/a
Download CSV