Transcript: Mouse NM_001110230.1

Mus musculus CUGBP, Elav-like family member 2 (Celf2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Celf2 (14007)
Length:
7749
CDS:
144..1706

Additional Resources:

NCBI RefSeq record:
NM_001110230.1
NBCI Gene record:
Celf2 (14007)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098675 GCGGTAAGTTTCACTCTTTAT pLKO.1 5286 3UTR 100% 13.200 18.480 N Celf2 n/a
2 TRCN0000236109 GGTTGTTGTTTCGTAACATTT pLKO_005 429 CDS 100% 13.200 18.480 N CELF2 n/a
3 TRCN0000074617 GATCGGCATGAAACGCTTGAA pLKO.1 1643 CDS 100% 4.950 6.930 N CELF2 n/a
4 TRCN0000236110 AGAATGCACTGCACAATATTA pLKO_005 478 CDS 100% 15.000 12.000 N CELF2 n/a
5 TRCN0000198543 GCTGCCCTCAAAGAGTATTTC pLKO.1 6464 3UTR 100% 13.200 10.560 N Celf2 n/a
6 TRCN0000098677 CGAGAATGATATCAGAGTGAT pLKO.1 611 CDS 100% 4.950 3.960 N Celf2 n/a
7 TRCN0000181411 CAGGTATTCAATGAGGGAGGT pLKO.1 6215 3UTR 100% 2.160 1.728 N Celf2 n/a
8 TRCN0000176651 CGTTCCTGATAAGTGAATAAA pLKO.1 7254 3UTR 100% 15.000 10.500 N Celf2 n/a
9 TRCN0000074616 CCCAGAATGCACTGCACAATA pLKO.1 475 CDS 100% 13.200 9.240 N CELF2 n/a
10 TRCN0000098676 CCAGAGTAAAGGTTGTTGTTT pLKO.1 419 CDS 100% 5.625 3.938 N Celf2 n/a
11 TRCN0000074613 GCTCACTTTCTCATTAAGATA pLKO.1 2277 3UTR 100% 5.625 3.938 N CELF2 n/a
12 TRCN0000098679 CAACAAGATGAACGGAGCTTT pLKO.1 245 CDS 100% 4.950 3.465 N Celf2 n/a
13 TRCN0000098678 CATAGGAATGGTTTCCAAGAA pLKO.1 584 CDS 100% 4.950 3.465 N Celf2 n/a
14 TRCN0000198941 GCCCTCAAAGAGTATTTCCCA pLKO.1 6467 3UTR 100% 0.750 0.525 N Celf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.