Transcript: Mouse NM_001110276.1

Mus musculus intersectin 1 (SH3 domain protein 1A) (Itsn1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Itsn1 (16443)
Length:
6154
CDS:
262..2127

Additional Resources:

NCBI RefSeq record:
NM_001110276.1
NBCI Gene record:
Itsn1 (16443)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110276.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111567 GCATTTGGTATAGGAGGGATT pLKO.1 601 CDS 100% 4.050 5.670 N Itsn1 n/a
2 TRCN0000026173 GCGGGATTTATTACTGGTGAT pLKO.1 367 CDS 100% 4.050 5.670 N Itsn1 n/a
3 TRCN0000111566 CGGACATGAATAACGATGGAA pLKO.1 455 CDS 100% 3.000 4.200 N Itsn1 n/a
4 TRCN0000328078 ATCCTAGCTATGCACCTAATT pLKO_005 1099 CDS 100% 13.200 9.240 N Itsn1 n/a
5 TRCN0000328006 GATACTCAGTGACCAGTTAAA pLKO_005 1896 CDS 100% 13.200 9.240 N Itsn1 n/a
6 TRCN0000026190 GCTGAAATACAGGCAGTTATT pLKO.1 927 CDS 100% 13.200 9.240 N Itsn1 n/a
7 TRCN0000328009 TGAAGCCGATAGCGGGATTTA pLKO_005 356 CDS 100% 13.200 9.240 N Itsn1 n/a
8 TRCN0000111565 CCAGGCAAGAACTATTCTCAT pLKO.1 990 CDS 100% 4.950 3.465 N Itsn1 n/a
9 TRCN0000111568 GAGAGCTAAGAATTGCTGAAA pLKO.1 1808 CDS 100% 4.950 3.465 N Itsn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110276.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.