Transcript: Mouse NM_001110506.1

Mus musculus EF-hand calcium binding domain 12 (Efcab12), mRNA.

Source:
NCBI, updated 2015-09-23
Taxon:
Mus musculus (mouse)
Gene:
Efcab12 (212516)
Length:
2551
CDS:
281..2302

Additional Resources:

NCBI RefSeq record:
NM_001110506.1
NBCI Gene record:
Efcab12 (212516)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198227 CCTTCGTAGTCGAAAGATCAA pLKO.1 1168 CDS 100% 4.950 6.930 N Efcab12 n/a
2 TRCN0000197803 GAGGGTACAAACAAACAAGAA pLKO.1 375 CDS 100% 4.950 3.960 N Efcab12 n/a
3 TRCN0000182390 GCTGGACAATAAGCCCAACAT pLKO.1 976 CDS 100% 4.950 3.960 N Efcab12 n/a
4 TRCN0000176494 CAACATCACATCATCAGAGTT pLKO.1 991 CDS 100% 4.950 3.465 N Efcab12 n/a
5 TRCN0000197497 CCATGCCTATTATGATGCAAA pLKO.1 2260 CDS 100% 4.950 3.465 N Efcab12 n/a
6 TRCN0000178437 GATTTCAATCAGGAGAGCCAA pLKO.1 1063 CDS 100% 2.640 1.848 N Efcab12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.