Transcript: Mouse NM_001110784.1

Mus musculus X-linked lymphocyte-regulated 3A (Xlr3a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Xlr3a (22445)
Length:
1694
CDS:
147..812

Additional Resources:

NCBI RefSeq record:
NM_001110784.1
NBCI Gene record:
Xlr3a (22445)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255203 CTGGTAGGGAGGACATTATTT pLKO_005 259 CDS 100% 15.000 7.500 Y Xlr3b n/a
2 TRCN0000249028 GCTGGTAGGGAGGACATTATT pLKO_005 258 CDS 100% 15.000 7.500 Y Xlr3c n/a
3 TRCN0000216496 CAGCTTAATTCGCCATCATTT pLKO.1 1422 3UTR 100% 13.200 6.600 Y Xlr3c n/a
4 TRCN0000249027 CCTTGGTAGCATCGCAATTAC pLKO_005 1038 3UTR 100% 13.200 6.600 Y Xlr3c n/a
5 TRCN0000257849 TATGGAGCAACAGAAGTTTAT pLKO_005 569 CDS 100% 13.200 6.600 Y Xlr3c n/a
6 TRCN0000255204 TCGAAGAGCCACCTAACAAAG pLKO_005 337 CDS 100% 10.800 5.400 Y Xlr3b n/a
7 TRCN0000183016 CGAAACACTCTCTAATATGTT pLKO.1 548 CDS 100% 5.625 2.813 Y Xlr3a n/a
8 TRCN0000179132 GCCACCTTGGAAATCAAACTT pLKO.1 723 CDS 100% 5.625 2.813 Y Xlr3a n/a
9 TRCN0000179260 GCTAACAGAGAAGTCCTTGAT pLKO.1 237 CDS 100% 4.950 2.475 Y Xlr3a n/a
10 TRCN0000183771 CCTAACAAAGTTCTTCAGGAA pLKO.1 348 CDS 100% 2.640 1.320 Y Xlr3a n/a
11 TRCN0000191756 GCATACAAACTCAAGAAACAT pLKO.1 525 CDS 100% 5.625 2.813 Y Xlr3c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.