Transcript: Mouse NM_001110851.1

Mus musculus cAMP responsive element modulator (Crem), transcript variant 7, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Crem (12916)
Length:
1587
CDS:
215..736

Additional Resources:

NCBI RefSeq record:
NM_001110851.1
NBCI Gene record:
Crem (12916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085694 CAGAAGTAATTGATTCGCATA pLKO.1 513 CDS 100% 4.050 3.240 N Crem n/a
2 TRCN0000273840 GCAGTACCAACTAGCATATAT pLKO_005 671 CDS 100% 15.000 10.500 N CREM n/a
3 TRCN0000085695 CCTGGTATTCCCAAGATTGAA pLKO.1 602 CDS 100% 5.625 3.938 N Crem n/a
4 TRCN0000085696 GCCTGGTATTCCCAAGATTGA pLKO.1 601 CDS 100% 4.950 3.465 N Crem n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06036 pDONR223 100% 61.6% 55.3% None (many diffs) n/a
2 ccsbBroad304_06036 pLX_304 0% 61.6% 55.3% V5 (many diffs) n/a
Download CSV