Transcript: Mouse NM_001111079.1

Mus musculus ubiquitin-like, containing PHD and RING finger domains, 1 (Uhrf1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Uhrf1 (18140)
Length:
3559
CDS:
238..2562

Additional Resources:

NCBI RefSeq record:
NM_001111079.1
NBCI Gene record:
Uhrf1 (18140)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001111079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239573 ATAGGGCTCTGGCACTCAATT pLKO_005 1742 CDS 100% 13.200 18.480 N Gm5648 n/a
2 TRCN0000039482 CACACACTCTTCGATTATGAT pLKO.1 403 CDS 100% 5.625 7.875 N Uhrf1 n/a
3 TRCN0000302343 CACACACTCTTCGATTATGAT pLKO_005 403 CDS 100% 5.625 7.875 N Uhrf1 n/a
4 TRCN0000039481 ACGTGAGCTATACGGCAACAT pLKO.1 981 CDS 100% 4.950 6.930 N Uhrf1 n/a
5 TRCN0000039479 CGATTATGATGTGCGCCTCAA pLKO.1 414 CDS 100% 4.050 5.670 N Uhrf1 n/a
6 TRCN0000239575 CCAGTTAACCAGGCATCTATA pLKO_005 2667 3UTR 100% 13.200 10.560 N Gm5648 n/a
7 TRCN0000311102 ATGGAGTGGACATTGTCAAAG pLKO_005 806 CDS 100% 10.800 8.640 N Uhrf1 n/a
8 TRCN0000039480 CGTGACAATATCTTCGGTGCA pLKO.1 655 CDS 100% 2.160 1.728 N Uhrf1 n/a
9 TRCN0000239574 TGACCAGAAGCTCACTAATAA pLKO_005 1719 CDS 100% 15.000 10.500 N Gm5648 n/a
10 TRCN0000311100 AGGTGGTCATGGCCAACTATA pLKO_005 887 CDS 100% 13.200 9.240 N Uhrf1 n/a
11 TRCN0000239571 TGATGTGGACAATGGCAATTA pLKO_005 1632 CDS 100% 13.200 9.240 N Gm5648 n/a
12 TRCN0000311096 CTGTAGCTCCAGTGCCGTTAA pLKO_005 732 CDS 100% 10.800 7.560 N Uhrf1 n/a
13 TRCN0000039483 CGGATCATGTTTGTGGATGAA pLKO.1 1036 CDS 100% 4.950 3.465 N Uhrf1 n/a
14 TRCN0000304673 TCATGTACCATGTCAAGTATG pLKO_005 770 CDS 100% 10.800 6.480 N Uhrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.