Transcript: Mouse NM_001111121.1

Mus musculus coiled-coil domain containing 6 (Ccdc6), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ccdc6 (76551)
Length:
5511
CDS:
180..1589

Additional Resources:

NCBI RefSeq record:
NM_001111121.1
NBCI Gene record:
Ccdc6 (76551)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001111121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262121 CAGCTCAAGCAGACCTATATC pLKO_005 1238 CDS 100% 13.200 18.480 N Ccdc6 n/a
2 TRCN0000262119 ACGGGAACTATTGCCTATTAA pLKO_005 2289 3UTR 100% 15.000 10.500 N Ccdc6 n/a
3 TRCN0000262120 TAGAGCTGGAGACCTACAAAC pLKO_005 382 CDS 100% 10.800 7.560 N Ccdc6 n/a
4 TRCN0000282107 AGCAGCCCTGACAAGTTTAAA pLKO_005 1410 CDS 100% 15.000 9.000 N Ccdc6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07195 pDONR223 100% 85.8% 94.7% None (many diffs) n/a
2 ccsbBroad304_07195 pLX_304 0% 85.8% 94.7% V5 (many diffs) n/a
3 TRCN0000478109 CATGATCTCCTACGGATAAGACCT pLX_317 22.3% 85.8% 94.7% V5 (many diffs) n/a
Download CSV