Transcript: Human NM_001111125.3

Homo sapiens IQ motif and Sec7 domain ArfGEF 2 (IQSEC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
IQSEC2 (23096)
Length:
6037
CDS:
228..4694

Additional Resources:

NCBI RefSeq record:
NM_001111125.3
NBCI Gene record:
IQSEC2 (23096)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001111125.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139643 CCAGAGATCCTCGTACTCTTT pLKO.1 4952 3UTR 100% 4.950 6.930 N IQSEC2 n/a
2 TRCN0000110127 GAAAGGTATGATGCGGCCTAA pLKO.1 3521 CDS 100% 4.050 5.670 N Iqsec2 n/a
3 TRCN0000140363 GAAAGGTATGATGCGGCCTAA pLKO.1 3521 CDS 100% 4.050 5.670 N IQSEC2 n/a
4 TRCN0000144705 GCTGAACGAAAGATGAAACTA pLKO.1 2931 CDS 100% 5.625 4.500 N IQSEC2 n/a
5 TRCN0000142627 CCACCTACAACTGAAGACAAT pLKO.1 5513 3UTR 100% 4.950 3.960 N IQSEC2 n/a
6 TRCN0000141916 CCGCATGAACAAGAACTTTGA pLKO.1 1310 CDS 100% 4.950 3.465 N IQSEC2 n/a
7 TRCN0000139603 CGTACAGTTTCCGTCAGTCTT pLKO.1 3280 CDS 100% 4.950 3.465 N IQSEC2 n/a
8 TRCN0000142648 GCAATTCCAATGAGACCATCA pLKO.1 2335 CDS 100% 4.050 2.835 N IQSEC2 n/a
9 TRCN0000140259 GCAGTTCAACAGAGACGTGTT pLKO.1 2663 CDS 100% 4.050 2.835 N IQSEC2 n/a
10 TRCN0000139818 CCACACACTTCCATGTGTCTT pLKO.1 5207 3UTR 100% 0.495 0.347 N IQSEC2 n/a
11 TRCN0000139688 CCTCCTCTTCATCTGCTTCTT pLKO.1 3916 CDS 100% 4.950 2.970 N IQSEC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111125.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.