Transcript: Mouse NM_001111336.1

Mus musculus hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 4 (Hsd3b4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Hsd3b4 (15495)
Length:
1698
CDS:
193..1314

Additional Resources:

NCBI RefSeq record:
NM_001111336.1
NBCI Gene record:
Hsd3b4 (15495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001111336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441083 ACATGGCCCTGGGTGTTATTA pLKO_005 1331 3UTR 100% 15.000 7.500 Y Hsd3b4 n/a
2 TRCN0000414008 CACAGTGCTAAATAGTGTATT pLKO_005 1152 CDS 100% 13.200 6.600 Y Hsd3b4 n/a
3 TRCN0000438614 CAGTACTGAAGGGAGACATTC pLKO_005 362 CDS 100% 10.800 5.400 Y Hsd3b4 n/a
4 TRCN0000438416 TTGCAACCCTTCAGCTCTAAG pLKO_005 1460 3UTR 100% 10.800 5.400 Y Hsd3b4 n/a
5 TRCN0000041679 GCACAGGGAGATTGGAAACAA pLKO.1 1281 CDS 100% 5.625 2.813 Y Hsd3b4 n/a
6 TRCN0000041682 CAACGTGCCAACATTCATCTA pLKO.1 537 CDS 100% 4.950 2.475 Y Hsd3b4 n/a
7 TRCN0000041678 CCAACTCTTAACAATTCCATT pLKO.1 1381 3UTR 100% 4.950 2.475 Y Hsd3b4 n/a
8 TRCN0000041681 GCACTGAAGAACAACAGCATA pLKO.1 805 CDS 100% 4.950 2.475 Y Hsd3b4 n/a
9 TRCN0000041680 ACCACCATTTAACCGCCTCTT pLKO.1 1128 CDS 100% 4.050 2.025 Y Hsd3b4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.