Transcript: Mouse NM_001112714.2

Mus musculus Ral GTPase activating protein, alpha subunit 1 (Ralgapa1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ralgapa1 (56784)
Length:
8277
CDS:
750..6857

Additional Resources:

NCBI RefSeq record:
NM_001112714.2
NBCI Gene record:
Ralgapa1 (56784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001112714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350064 GTAGATTATGATCCGTTTATG pLKO_005 5121 CDS 100% 13.200 18.480 N Ralgapa1 n/a
2 TRCN0000088159 CCAGCCTAACTACGCTTCATT pLKO.1 3616 CDS 100% 5.625 7.875 N Ralgapa1 n/a
3 TRCN0000317534 CCAGCCTAACTACGCTTCATT pLKO_005 3616 CDS 100% 5.625 7.875 N Ralgapa1 n/a
4 TRCN0000088162 CCTCGGACTTTAGATAATCTT pLKO.1 1248 CDS 100% 5.625 7.875 N Ralgapa1 n/a
5 TRCN0000317532 CCTCGGACTTTAGATAATCTT pLKO_005 1248 CDS 100% 5.625 7.875 N Ralgapa1 n/a
6 TRCN0000088158 GCCTCATTACAACTTTATGAT pLKO.1 7363 3UTR 100% 5.625 7.875 N Ralgapa1 n/a
7 TRCN0000317535 GCCTCATTACAACTTTATGAT pLKO_005 7363 3UTR 100% 5.625 7.875 N Ralgapa1 n/a
8 TRCN0000088160 CCTGGATCAAAGCAAATCTAA pLKO.1 2626 CDS 100% 5.625 3.938 N Ralgapa1 n/a
9 TRCN0000317605 CCTGGATCAAAGCAAATCTAA pLKO_005 2626 CDS 100% 5.625 3.938 N Ralgapa1 n/a
10 TRCN0000088161 CCTCATTGTAATATACCCAAT pLKO.1 6533 CDS 100% 4.050 2.835 N Ralgapa1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001112714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.