Transcript: Mouse NM_001113179.1

Mus musculus BUB1, mitotic checkpoint serine/threonine kinase (Bub1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-16
Taxon:
Mus musculus (mouse)
Gene:
Bub1 (12235)
Length:
4337
CDS:
115..3294

Additional Resources:

NCBI RefSeq record:
NM_001113179.1
NBCI Gene record:
Bub1 (12235)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040157 CCTGGGTCAGAGTATAGATAT pLKO.1 2874 CDS 100% 13.200 18.480 N BUB1 n/a
2 TRCN0000288684 CCTGGGTCAGAGTATAGATAT pLKO_005 2874 CDS 100% 13.200 18.480 N BUB1 n/a
3 TRCN0000012852 CGGATTGTCATAATCTTCCAT pLKO.1 3152 CDS 100% 3.000 4.200 N Bub1 n/a
4 TRCN0000344981 CGGATTGTCATAATCTTCCAT pLKO_005 3152 CDS 100% 3.000 4.200 N Bub1 n/a
5 TRCN0000012849 CGCTATCAGAATGCTTTACAT pLKO.1 2730 CDS 100% 5.625 3.938 N Bub1 n/a
6 TRCN0000344980 CGCTATCAGAATGCTTTACAT pLKO_005 2730 CDS 100% 5.625 3.938 N Bub1 n/a
7 TRCN0000012848 CCAGCAGATTTAGTACAGATT pLKO.1 1918 CDS 100% 4.950 3.465 N Bub1 n/a
8 TRCN0000344979 CCAGCAGATTTAGTACAGATT pLKO_005 1918 CDS 100% 4.950 3.465 N Bub1 n/a
9 TRCN0000012851 GCTCCAACACTTCCTGACATT pLKO.1 1510 CDS 100% 4.950 3.465 N Bub1 n/a
10 TRCN0000344978 GCTCCAACACTTCCTGACATT pLKO_005 1510 CDS 100% 4.950 3.465 N Bub1 n/a
11 TRCN0000012850 GCTGAACCTAAAGAACTACTA pLKO.1 502 CDS 100% 4.950 3.465 N Bub1 n/a
12 TRCN0000345051 GCTGAACCTAAAGAACTACTA pLKO_005 502 CDS 100% 4.950 3.465 N Bub1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.