Transcript: Mouse NM_001113553.1

Mus musculus interleukin-1 receptor-associated kinase 2 (Irak2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Irak2 (108960)
Length:
3065
CDS:
82..1806

Additional Resources:

NCBI RefSeq record:
NM_001113553.1
NBCI Gene record:
Irak2 (108960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378514 GGGCACCTTTGCCGATATCTA pLKO_005 585 CDS 100% 5.625 7.875 N Irak2 n/a
2 TRCN0000361914 GACGACCTGTGCCGCAATATC pLKO_005 121 CDS 100% 4.400 6.160 N Irak2 n/a
3 TRCN0000022503 CCGATATCTACCAGGGTCAAA pLKO.1 596 CDS 100% 4.950 3.960 N Irak2 n/a
4 TRCN0000022500 CCACAGGCTCATCTTCCAATA pLKO.1 1481 CDS 100% 10.800 7.560 N Irak2 n/a
5 TRCN0000378471 TTTGACCAAAGCCACCGAATC pLKO_005 559 CDS 100% 6.000 4.200 N Irak2 n/a
6 TRCN0000022501 CGTCCCTTCTTTGGTTATGAT pLKO.1 1542 CDS 100% 5.625 3.938 N Irak2 n/a
7 TRCN0000022499 CCCAGTCTAAGTATTGCAGTA pLKO.1 443 CDS 100% 4.050 2.835 N Irak2 n/a
8 TRCN0000022502 GCTGAGGAAGATCAAGTCCAT pLKO.1 204 CDS 100% 2.640 1.848 N Irak2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.