Transcript: Mouse NM_001114098.1

Mus musculus microtubule crosslinking factor 1 (Mtcl1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Mtcl1 (68617)
Length:
7297
CDS:
408..6089

Additional Resources:

NCBI RefSeq record:
NM_001114098.1
NBCI Gene record:
Mtcl1 (68617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001114098.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263447 CCCTCTGAACAGCCTAGATAT pLKO_005 5153 CDS 100% 13.200 18.480 N Mtcl1 n/a
2 TRCN0000193062 CCGGAATAGTTCACTGTAATT pLKO.1 6330 3UTR 100% 13.200 18.480 N Mtcl1 n/a
3 TRCN0000263444 TGAATGTTCAACCTGGTAAAC pLKO_005 6453 3UTR 100% 10.800 15.120 N Mtcl1 n/a
4 TRCN0000263446 TGGATGGTCTCTCGCCCTTAT pLKO_005 3067 CDS 100% 10.800 15.120 N Mtcl1 n/a
5 TRCN0000263443 CCAGGATGACAGTGCGGATTT pLKO_005 1877 CDS 100% 10.800 14.040 N Mtcl1 n/a
6 TRCN0000263445 GAGTGCCTGGTGACCATAAAG pLKO_005 2817 CDS 100% 13.200 9.240 N Mtcl1 n/a
7 TRCN0000190381 CCCGACGACTTGAAATACATT pLKO.1 4629 CDS 100% 5.625 3.938 N Mtcl1 n/a
8 TRCN0000190865 GCAGAAGTATAAGTCCCTCTA pLKO.1 1994 CDS 100% 4.050 2.835 N Mtcl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114098.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.